Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST117
Clone ID XST117
Vector pGT1TMpfs
Project baygenomics

Sequence tag XST117
Sequence
GCCACCGAGAGCACAGTGAGGATCTCTCNGCTCCCAGTACTCCTAGGCAGCCTGTGGACNCCCCAGGGCTCAGCACAGTG
GCGTCAGTGACAGTGTCCCACCAAGTCCAGGGTGACATGGCTGGCAGAGGGAATGAGGAGCAGCCACATGGTATGAGGTT
CCTGTCCNTCTTCTTCCCTATTG
Sequence Type mRNA
Unitrap ID UNI10133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21550246..21550883 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032193 (Ldlr) NM_010700 low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:96765]

 
Come back to gene ENSMUSG00000032193


For any suggestions or comments, please send an email to unitrap@crg.es