Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P149A12
Clone ID P149A12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P149A12
Sequence
TCTGGTGGGAGCGAAACCAACGCCTGGCTGGGAGCAGCCNNCCGGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP149A12
Sequence
TGTTTGGGTGTGGTTCTGTGGCTCCTAGGTAGGTGCTGTAGGCATGTAGTGCTGCAGGAAGCTCCAGAATGTGCATTTAT
TCTGGAAGCCCTGACTCCAGTTACAAGTCCAGATTCTGTTCCTGAGAGGAAGACAAGACACAGAACAGTAGGTATCTGCT
TTAAGAAGATTTACACAAACAATGTGGCAAGATGTATCCCCATTGGAGCCTTTAGAAGTTTCAAAAATTGTTTCATGAAT
TCCTTATTGTAGCTCTACTACAG
Sequence Type genomic DNA
Unitrap ID UNI10213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59033848..59034110 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048076 (Arf1) NM_007476 ADP-ribosylation factor 1 Gene [Source:MGI (curated);Acc:Arf1-001]


SPLK-Sequence tag 3SP149A12
Sequence
AGAAACAATATAAANNNGAGGGTCAGCATTTTAGTTGCTGTAGTTCAAAAACTTAAGAGTTTTAACTTGAGTATGGGTAT
AGACCTTGATTTGTGTGTGTGTGTTGGAGGGGGTTTCACCTTAAGTTTGCAAAGAAGGCTCTAATTTCAATTTCACTCAT
CATCCTACCTACAATTCAGACCTGGTGGCTTTCCCCTGCCCTGAAGAAGCTTCGAGGAGGCAGTGAGCCACTGTTGATTG
AGTCACAGTTTTGCCCTTCCAAGAGGGCTTGCCTGTCTTAGTATCAGCACATTCAATTTTACTCTTAAGCAAATTTTATG
AAATAACGACAAAATGGAGAGCANNCCTTNGNATTGCATGGACATTACTTAGAAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048076


For any suggestions or comments, please send an email to unitrap@crg.es