Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P148G09
Clone ID P148G09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP148G09
Sequence
GGGATGTTCCCTCTGCTGGGGACTCTAGCTTCCTGTAGGATGGGGTGATGTCTCTGCTGTAGCGATAGCTTCTCACCATC
CCTTTGCTAAAGAAAATAATCTACCACATGCATCCAGATGATCTCCTCCTCCTGGTATCTGTCGGGTGGACACAATACTC
CTGCTGCATTTCCAGGAAGCACATATTCTGAGACTCTTAGCTGGAACTTAACTTTTTGGAAGAGGTGTGCTGTATGTGGT
GGGAGAGGATGCCATTCAGAAGTTGGTGNNTGCGTTGACAGCATGGCTGAATTAGGAGAAGGTGAACTCAGACTCTGCCT
CCTGTCTAGCAAGTGCTTCTGCCTTGATCCTGGCTAATGAATTAATAAACATGAAAAGCCTTCCCTTTGTACTGATCTGA
CTCAGCTCTCTGTGTCTGTGCTGATACTTTTGATAATGGTACAGGTGTTCTTGGGCAAAGTCACCTTTGCCCAATAATGT
GCTTCTTCCTTCTATGCAGAAGGTTGGAGAACCTAAACTTATGATCTGTTAGTTGTGTTTTCTTGCATGTAACTTTTGGC
AACCTTCAGTGAGAGCTGGATGATTCTTTAACTGTTCCTTTGCTGTTGGTAAGTGGGTTTCATTGAGAAAGGTTGTACTT
GGCACTTGTAGGGCTTGTAAGGCCTGGTGTCCTTCTGCAGGCAAATGCTAGACCAGGGAAGGACAGTGTGTGACATTTGT
AAC
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12355865..12356586 705
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]


SPLK-Sequence tag 3SP148G09
Sequence
TTGGTCTCTTGTTCTTGATGCCTTTGTTAAAGTGACAGTGCATTANNTTTAGGAGTGCAGTGCAATCTGCTTAGATCATG
TTGGCTGGTAAGCAGAGACAGGAAGGGCAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es