Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P148G07
Clone ID P148G07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P148G07
Sequence
TTGCATTGTGGGACTGAACAACTGCTAGAAGCATGGAATGNNATTCACAACTGCTGCAGACCATTCTTGGGAGTTGGGCT
ACAACAT
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP148G07
Sequence
ATAAAGCTGTGAGACTGAAATAGCATTCTGATTTCTAACGAGTTCTCTTACNNCCNNAGTGCTGATACTTCAGCACTGCC
AGACGATGCCATTTCTTACATCGTGATTTATTTTAGCAAGGCATATACATACCTTCTTTCATAAACTTACTTTGGCCTGT
GATTGCCTTTCTCCAGAGAGTACTAAGTTGCCTAACTTAGGATCATAGTGTTATGATCTGGAATGCTAGGCACTTAGTAA
TTC
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13181782..13182024 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]


SPLK-Sequence tag 3SP148G07
Sequence
GCTTTAAGAGTAGATGGCATCCTCTATATTCTTTATACTGTCTACACAAATAACTTAAGTTTAAAAATATATTTATTC
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13181689..13181766 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es