Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P148E06
Clone ID P148E06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P148E06
Sequence
AATACANCAAACCCACACCGCNNAACACACGCCACAAACAATNNNNCACCCACACGCCACAACANNTGACCANNAACTGA
CNNANCAAAACCCAGCCAACACATNNAAACAACCCAACGNNAGACGATCGCCCAAAATACACAATCCCATACAAACAGCA
CAGCGCACGCTCACAACTCGANNACNNNCCACACCAACTACCATCAAANNCGCCCAAAAGAACNNNNCAACAACCAACAA
TGCAACACCTCNNCACGAAAANNAAGAGNNAAAGAACCACGAACCCCCNNCCGNNAACNNNNNNNNNNNNNNNNNNNTCA
ACNNCCGCAAANNCACCATCNNTCCACCCAACAGCACAAACTACCAGCCCAAATCACACANNCAGCACNNAAAGCACCCA
ACTAACAATGAACACACACACCCGACACTCCCANNAAGAGANNNNCCATACTTATACNCCACCCTCTCCTAACAAACAGG
GGACGGGGGGGGCGCTGGCGGCGTACTTTTCAGCCAAGNNNNNNNNNNNNNNNNNNNNNNNNNGAACCACTGATGCACAT
GCTGGCAGGACGGCCGGAAGGGGTCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCCCCCGGCTATTCAGTNNNNN
NNNNNNNNNNNNNCTTTTCAGCCAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77996527..78600926 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065676 (SNORD42)  


SPLK-Sequence tag 5SP148E06
Sequence
ATCTTTGCCTGTGGTATCGTGCATATGATGGAAAAAATCTGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77996602..77996644 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065676 (SNORD42)  


SPLK-Sequence tag 3SP148E06
Sequence
CACACTTAATTTTAATTGTCCTCTCCCAGCTCCTGCCCCTCCCAAAGCCGAAGCCAAAGCGAAGGCCTTGAAAGCTAAGA
AGGCGGNNCTGAAAGGCGTCCACAGCCACAAAAAGAAGAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI27053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77996393..77996517 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058546 (Rpl23a) NM_207523 ribosomal protein L23a Gene [Source:MGI (curated);Acc:Rpl23a-001]

 
Come back to gene ENSMUSG00000058546


For any suggestions or comments, please send an email to unitrap@crg.es