Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P148D10
Clone ID P148D10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP148D10
Sequence
GATCTGTGTAGCTCAGGCTACCCTGAAATGCATTGTATAGTCCAGGCTGGTCTTGAACTCTTGACCAAATGTTAGGCTTT
TGGGTGTGAACCACTACCCTGCTGATAAATTATTTTTAAAGTGGTAAAAGGCCCCCGCTGACGGGTGTCAATCATTCAGA
GCACCGATC
Sequence Type genomic DNA
Unitrap ID UNI11806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22329321..22329447 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]


SPLK-Sequence tag 3SP148D10
Sequence
TGTTTTTTTTTTATGGTTATCGGCTTCATGGGTGTCAGGTGCATTTCAGTACATTCACATTGTTGTTTGACCTCACCTCT
TTCTCACCTCTCACTGTTTTCAAATGGAGGCTCATACTTATAAAACAGTTTCTCTCCACACTGAGGTCCTAGCAATGCAT
GCTTTGTTTATAAGTTATATATGGATGTTTTATAGAAATGCAGTTATAGGATATCTGACCTTTGTGTCTAGTTTCTTTTA
CAGTATAATATGTTTCAGTGTTCATCCATACTGTAATAGTATATATTAGTCCTTTATTCTCATCCTCTCTCTCTCTCTCT
CTCTCTCTCTCTCTCTCTCTCTCTCTCT
Sequence Type genomic DNA
Unitrap ID UNI11806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22329449..22329762 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es