Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P147H10
Clone ID P147H10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP147H10
Sequence
GATCCTTAGAAGTACCCCCTTCACTTAGTGGGACCTTGGTGGCTTATGAGCAGGGAGTTGTGAGAATGCAGCGTGACATA
GTATCCGAGAGAAGATCGGAATCTGATTGAGGTCACTGCCAAGTTAGGTGTTTTAAAAGAACTAACCTAGGAGTCTTTCT
GGAGTCTGGGCTTCTCCCAACTGTGCTGGGATTCGCGTGTACTTATCTCTCGGTACCAAGGTAGGTAGGTTATGNNCTGC
ACGCTTGTCCTGGGCTCACAGAATCTGCTAATGCAGTTTAAGCTCACTGTTGGCGGCCCTACAGAACAAACTATTGGGGT
TTGGAGGTGTGAAGAGATAACTTATCCGGGTCTCCTATAGGCTTGGACTGAAGGTGGGCAGAGATTATACTCCAGGGTTT
ATATAAATCTATCCTGTCTGGACAGAAGATGAGGGGGTCGTTGTTGTCATTTTGGCTTGGGACGTGTGCGTGATGAATAT
GTGAGAGAANNNCTTCGTTTTCAACCTCATGAATTTGTTCTCTTTTTTACTGTGTTAGAGAAATAAGCCGAAATCATTGA
GAAACTCACAGAATGCAAACTAGTGTATCTGAGANNTGCTCTTTTGTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49777794..49778405 596
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]


SPLK-Sequence tag 3SP147H10
Sequence
GGGCGTGTCAGTGTTAGAGTAGAAAGATAGAGTTGGTCTTCTCTAACTACTAGTTCTGCATCTGGGCTTTCAACCAGCCA
GTGCTCATGCTATGTGGTTAGGTCTGTAGTAGTGACATGTACTGTACGTGTACAAACGTAATGTCTTGGTCATTATTTCC
TAAGCAATATAGTATAGCAATTGTGTATCTAGGATTTAAATGTATTAGGTAGGATAAGTAAAGATTAGTTAAAATACACC
GGCAGATGCATGTAAATTATAGGCTAATACTATGTTTATAAGAGAATTAAGCATCCTTGTATTTGGGTGTTCCAACAG
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49778404..49778715 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es