Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P147H02
Clone ID P147H02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP147H02
Sequence
TTGAGGCCCGCTTAGGCTAAATTACAAAATCCCGCTTCAAAAAAAAAAAATGTTCCTCTTAATTCTATCCAGTGGAACTC
AATTGTTGCACCAAAGCATTAAGAATGTACGTTACCTATCTGTCTTTTGTTACTGGGAATGAAACCTAACTTTGATTGGT
AGCTATACGATTAGCCTCTCTCTATCTTAACTGATTGGTTACTTTTCAG
Sequence Type genomic DNA
Unitrap ID UNI10758

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108211582..108211790 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007815 (Rhoa) NM_016802 ras homolog gene family, member A Gene [Source:MGI Symbol;Acc:MGI:1096342]


SPLK-Sequence tag 3SP147H02
Sequence
AAANNTACAATATTTAAGTATGCATCTTACTTACTGTTAGTGTTTTGGTGACATTAGATATTGGTGACAATAAGTTTTGA
AAGTAATTTGAAATTAATTATTGTAAAATCCCTAATTCTGGTGACT
Sequence Type genomic DNA
Unitrap ID UNI10758

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108212160..108212285 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007815 (Rhoa) NM_016802 ras homolog gene family, member A Gene [Source:MGI Symbol;Acc:MGI:1096342]

 
Come back to gene ENSMUSG00000007815


For any suggestions or comments, please send an email to unitrap@crg.es