Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P147G08
Clone ID P147G08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P147G08
Sequence
CCTCAGGCAACTCTGCCCACCTCAGGTCTCACCCCTGGAGCTGGCCCAGTTCAAGGGGTGGGTCCTGCGCCGACTCCTCA
CTCACTTCCAGAACCTGGATCACAGCAACAAACATTTGCGGTCCCCCGGCCACCACATCAGCCCCTGCAAATGCCAAAGA
TGATGCCTGAAAGCCAGTATCCATCAGAACAGAG
Sequence Type mRNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22411706..22411899 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 5SP147G08
Sequence
GATCTGCTGTCATCCTGAGCCTCACTCAAGTAAAAATAAAAGGCAGGTCAGGNNCTGCCGCATCTTCATTTTTGCTGGAT
TCTGCTTCCGGCATTTTCTGGTTATTACAGATTCTGGTTTCCCTCCACTTTGCTTCTGCCCTCGTATATCTTGATGGTTT
CTACTCTTAGTAAGGTAATTTATAAACGGCTTCTCCCACCCCTGAAATTGTACATATGTTCTCATATACATTTGCTTCAT
AATGTGAAGTCTTTCATCCATAACATTTATGTTAGAATGCAGTGTAAAATGGAACCTAGCCTTCCCTACACATTTGAAAT
GATTTAACAGGTAATAAAAGGATTAAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22402372..22402723 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es