Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P147G06
Clone ID P147G06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P147G06
Sequence
ATTTTTATAGATTTTGTTATAATCATGGTGCTGGGAAAGGTAAAGAGTTTGACAATAAGCTTTGACTGTCTTAATGACAG
TAATGTCCCCGTGTATTCTAGCGGGGANNNTGTCTCAGGAAGGGTAAATTTAGAAGTNNNCGGGGAGATCAGAGTAAAAT
CTCTTAAAATTCACGCAAGAGGACATGCGAAAGTACGGTGGACGGAATCAAGAAACGCCGGCTCCAATACTGCCTATACA
CAGAATTACACTGAAGAAGTAGAATATTTCAACCATAAAGACATCTTAATTGGGCACGAAAGAGATGATGATAATTCTGA
AGAAGGCTTCCACACTATTCATTCAGGAAGGCATGAATATGCATTTAGCTTCGAGCTTCCACAGGC
Sequence Type mRNA
Unitrap ID UNI10900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81022887..81026746 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]


SPLK-Sequence tag 3SP147G06
Sequence
AACACTCAAGGAGAGNTCTGTTCTTTAGACACACATTCCATAGCTTTGTATACAGAGCTACTGAGGACATTACATAAGCT
ATCATAACCTGGACTTAAAAGGAAACGTCTGTCAGAGCCACCAGAGTGGAAAGCTTGAAATACAGTACATTCTTAGCATT
TTAACAGATTGTTGAGATAGAATATGTAAACATTTTTGCATAATGCCTCTTAAGACACTGGAGCCTGTAAACTGGCACCT
GCATTGATCTAGAGAATGAATTTAGCTCATATCAGTTTATCAGGCCTTGGCTGTATCTTAACTTTGTGTTTACTCGTTCT
GAATTAGAATTTTGTGTAGAGTTCATAACCATTGTAAAATAGTGGCACTTCTACCGGGATAATCTAGCTCTCTGGCTTGG
AAGTAACAATGCTGAACATTTCTCTAATGGGTCAGGCTGCTTCTTAAAACATTTTATAAACACCAAATCCTACAATCTGG
CCAAGTTTGAGAAACAGTTCTGACTCTTTTGACATAGGCTTATTAGAAATATTTTTCTTTTCAAGCCTTAGAAAGTAATG
CTAGTTAACAGCCAAGGGAGAGATAGAATAGGAGTGGACAGGGGTATAANAGAAAAATCTCATTTCTGTGAATTTATGAA
AAAGGCAAATGTGAGAGTATCCTAGACATTTTATGCT
Sequence Type genomic DNA
Unitrap ID UNI10900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81027171..81027846 656
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]

 
Come back to gene ENSMUSG00000074794


For any suggestions or comments, please send an email to unitrap@crg.es