Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P146E01
Clone ID P146E01
Vector FlipROSAbetageo
Project ggtc

Sequence tag P146E01
Sequence
CAGAACAGAAGTAGTCCTGGTCTTACCTACGCTCGTGGACGAGTCGCGTGGAGCTGTCGGCTCCCTGTTCTGCGCGTGCG
ATTGCGTTGAGACAGCTCCGTGAG
Sequence Type mRNA
Unitrap ID UNI10492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47165255..47165357 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]


SPLK-Sequence tag 5SP146E01
Sequence
GACCTCATGCCTGTCACCTCGGCTTCCTGGCCTGGGTCTCCGGGTTTTGTGCTAAGCACAGTTGGCTTGGGATGGGAGGT
CTTATCCCTCAATCCCCTCGGAGCTAGCAGTTCATGCAATCCATGCAGTCCTCTGCAGGTAACTTAAGTG
Sequence Type genomic DNA
Unitrap ID UNI10492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47165417..47165567 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]


SPLK-Sequence tag 3SP146E01
Sequence
ACTTCTGTCCACCTGTAGACTGAAGAATATTCTCCATTATTTTGTCACGTTCCCCACGGCTCTGAAGTACCAAGTAAACG
CAAACTATTAATTTTTTAAGTATCTTTCACCAAAGAGCCAAATTATTTTCTAAAATATAAGTTGTTACCATGCTTTATTT
TCCCTGTAGCTTAATTGAATAATTCAGCTTTTTAGAAAGCCTTTGAAGAGTTGTTTGACAGGCAACTGGTTGGTGTATTT
TGAGAAATAAAC
Sequence Type genomic DNA
Unitrap ID UNI10492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47165869..47166121 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

 
Come back to gene ENSMUSG00000025047


For any suggestions or comments, please send an email to unitrap@crg.es