Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P146D02
Clone ID P146D02
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP146D02
Sequence
GATCCTGTGTGTTTATCTGGTGATTCTATTAGCTAAAAGTAAGGCTAGAGGGGAACATAAGACAGGAACAAGGGAGTGGT
GGTGAAACTATACAGATTTATCAGGGAGGAGCAGAGATGAGAATAAACCAAAAGCACAGCAGGAGAGGGGAGAGCAGGAA
CCTGGGAGGAAGATGGAAGAGGAACAGGTTGAAAGGTCAACCCAGGCCAGATTATGGAGGCCT
Sequence Type genomic DNA
Unitrap ID UNI29474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20443282..20443504 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


SPLK-Sequence tag 3SP146D02
Sequence
CGAATTTAGAGCCCTGTGAATGAACGTAGAGACATGAGCCTGTTAGGCAAGAACTCTACTGTCTTAGTAGGCCGTTGGTG
GGCTGGGGTGTGGGCTGGGGCTTAACACCAGCGGACTGGGGGAAGGGCTGAANNCTNNCTGAGGAAACCCCGTGCGGCTC
TAGTCTAGATGGCGATAAGCAGATT
Sequence Type genomic DNA
Unitrap ID UNI29474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20443605..20443789 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es