Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145F04
Clone ID P145F04
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP145F04
Sequence
GATCCCGTTACAGATGGTTGTTGTGGCTGAATTTAGACTGGTGTCGACGCTAGTGGGACCTCTGGAAGAGCAGTCAGTGC
TCTTAACCACTGAGCCATCTCTCCAGCCCTTAAAGTAGGATTTTGCTGTGTATTTCTTGCTGCTAGACATTCACTAGACC
AGGCTGGCGTGGAACTTGTTCATCTTCCTGTCTTTGCCTGCTAAGTG
Sequence Type genomic DNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152057317..152057468 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]


SPLK-Sequence tag 3SP145F04
Sequence
CTGGGTNNNAGTTGTGTACACCATTCCATGTGGGTTTTTCTTTTAAACCTGGAAGTATAGATGAGACTTTTGAACTTTAG
GTTGATGCTATAGTAGTTTGAAATGTTGGGGACTTAACTTGATATAGGATGAATGTGTGTTGTGAGTGGCACAATGTAAA
TCTTTGGAGACAAAATGACCCCACTAAAATGTTGG
Sequence Type genomic DNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152057469..152057664 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es