Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145D06
Clone ID P145D06
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145D06
Sequence
CGAAGCNNNNTGCCACGGGCGCCTCCGAAGTGGAAGTCGGAGCGGGAGTTTTTGTTTGTGAAGGGCGGCCGCGAGGCCTG
AGGCTAACGTCAGGCTGAGGAGAACCCCCCGCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP145D06
Sequence
GGTCGCATCCTGGACCTCTACCCATAATTCCTTTCGTCTCTCGGCTCCTAGATATTTTACGCAGAGGCCCCTGGCTTCCT
GGATATTATCCTTATGGCCTCCCTTGAAATCCCTACTTCATAATCTTAAAGGTATGAAGCGAGCAACCTCTAGAGCGCGA
GGCTTCGACCTGGGTCCCACACCTCCTACTCCTTTTCCCCTTTGTTTTCTGTTACCAGCCTTAAGTTTTTCAGCTCTTAC
CAAGAGCTTTTCTTCAAGCAGATGTTGGTCACTCCCTTGACCAGGATAGCAGCATCCGTCTCCAAATCTCACACCTGTTT
GTTT
Sequence Type genomic DNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52650270..52650593 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]


SPLK-Sequence tag 3SP145D06
Sequence
GGGTGAAGGGGGCCTAAAAGAAAGCAGNNCTAAGTAAAGTATGCTAACATAACGTTTCTGGTCTTAGATTTGGCAAGATG
ACACAGTTTCTGCCTCCCAACCTTCTGGCCCTTTTTGCACCCCGAG
Sequence Type genomic DNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52650127..52650252 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es