Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145C09
Clone ID P145C09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145C09
Sequence
CTGCTGAGACGAAAGCTTCCCTGGGGCAGTCTCCGCATATCATGGGGAGATAGTTTTTTTTTCCT
Sequence Type mRNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131830338..131830390 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]


SPLK-Sequence tag 5SP145C09
Sequence
GATCTAGACACTCAGATAGCAGTAAGTAAATTCTTGGAGGNCNNCATGGGCAGAACTTGGTGAATGTGCTTCTGATCTTG
ACACCACAGCCGATGTCCAGAGTCAGTCTAATGACTCTAAAATGTAGGATTTCTGGCTGCTTTAGGCAAGAGCCTCAGCA
TGTCTTGAAGAATGCTAAAACACAATGGAAAAAGTTTGTTACCAGGAAAG
Sequence Type genomic DNA
Unitrap ID UNI15891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131837973..131838182 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]


SPLK-Sequence tag 3SP145C09
Sequence
TTGTGTTTGTTTGGCAGNNNNGNNNNTTGGATGTAAGCATGTTTTGGATGCTTCACCATGTTTTGAAAGTGAACTAATTG
TTTTCTTAAGCTTTGTGACTGAGTTTCAAGTATTTGATTGTGCTTCTGTTTATTTGAATTTAACATTATTTGATACTTAA
AATAATGCATGTACGTACTTAACCCAGTATTCTGCTTGTATGAAACCCTTTAAAATGTCTTACTTATTCTAGTTTACTTT
TTAAAATAAGATTGCTGATTTCACTTACTTTTTTCCTTATTTCAATTTTGTGAACTATTTCATTTCCGTTTTGGAGACAA
GATGGTTTCTAAAAACCAGGTGAGAGCAATGAAATTCCTTATTCCCTCCATTTTAATGTCAACGTCAAGAGGTCACCCTC
TCAGATAAGACTCAGAGTCTGACAGCTTTCCTGTTACTTTCAGAACTCAGCCAGCACTGCAGGTGTCTCTAGAGTAACCC
TGTCTGTTTCCCTTCTACAGCTGATTGGCCTTGGTCCTCACAGCTCTAAAAAGAAGCAGGAT
Sequence Type genomic DNA
Unitrap ID UNI15891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131838208..131838750 519
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es