Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145B10
Clone ID P145B10
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145B10
Sequence
CCGGGGGCGGAGAGGCGGAGGATCCTTCCTGTGTGGAAGCCGCAGATCCCGGTGAGCCCTCTCACCTGGCGCTCTCTCCA
TCCTCGGCGCGATAACCATGGCAGCAGGCTGCGAGGGCATCGCGCCCCCGACCCTGGGCGAGAGAACTGTGGGGGAGGAA
G
Sequence Type mRNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35770464..35770625 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]


SPLK-Sequence tag 5SP145B10
Sequence
GATCTGATGTCCTCTTCTAATGTGTCTGAAGACAGCTATGGTGTACTCATAAATAAAATAAATCTTTAAAAAAATATATA
AAGGCTGTGTGTGTGTTTTATTTGGGAACATAAATGGTCAAAGGCGGGAAGGAACCCCTGTGCTGGGATTTTTTAAAAAT
ATTTTTTACTACACCCATGGAAAAATAGGTAGAAGGACGTCCTTTGGCAAGATAAG
Sequence Type genomic DNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35773238..35773431 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]


SPLK-Sequence tag 3SP145B10
Sequence
CACAAACTGTCCCAAGCCTAGGAGTAAGTAAGAGAAGGAGGATGTAGTCCGGGGAGTGGAAGAGTTGGTGTGAGGAGTGT
TGAGAGGGATGCCCAGGTTTGATTGTGGGGGTAGTAGGATCAGATTTAAGTTTAGGACGATCACTCTGGGTGAAGATACA
GGATAGATTAGAGGGAGTTGACAATCCCCCNNNGCCTCAGTTTCCATTTTTATGTAATGCACAATTATTGTGAAATTTAA
GAATACATGTAGCCAGCTGAGCCTTAGTGTCTGGCAGGAATTAGATATCTGAGGATGATGGTCATTTTTTATTGCTAGCA
GCAAGCGCT
Sequence Type genomic DNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35773528..35773859 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

 
Come back to gene ENSMUSG00000022849


For any suggestions or comments, please send an email to unitrap@crg.es