Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145A06
Clone ID P145A06
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145A06
Sequence
GCCGTCGGGTCTGGAGGAGTCTCCTGGTCCCTTCGTTCCAGAGGCCTCCCGATNNNGGATACGGGAGCCAGAGGCCAGAG
AAGATTACTTTGGCACCTGTATCAAGTGCAACAAAGGTATCTATGGGCAGAGCAATGCCTGCCAGGCCCTGGACAGCCTC
TAGCACGGGCAGTGCTTTGTCTGCTGCTCCTGTG
Sequence Type mRNA
Unitrap ID UNI10754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55192229..55195160 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]


SPLK-Sequence tag 5SP145A06
Sequence
GATCCGATGGAGTAGCTTCATGGGTGTCAGGCTAAAATGGTCTGCCATGTAGAGTTGGGGAAAAAAAATCCCAGGAGCCT
CTGACCCCAAAGACTTG
Sequence Type genomic DNA
Unitrap ID UNI10754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55191298..55191394 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]


SPLK-Sequence tag 3SP145A06
Sequence
AAGCAGTAGCTTCCAAAGATGCCCTGACCACCACAGAGGCTAGACAGACGCGTGAGAATAGGATGGCTACAGTGAAATGA
AGAATCCTGGGCTAAAACATCCCAGAGGCTAAGGCCTGGAACCAGTGTTCCATGCAAATCAAATAATACCTAGTCTAGTC
AGAGCTTCTTAGCAGGTACACCAGCCTGGCCTGACCTTGGCTCTCTCTTAGGTGGCTCCCCATGCCTTGAGCCCTGAGGA
GGTGTGGGTGGCAGACAGCTATTGAAGACACAGGAGCTAGAGGAGGAAGGAGCAGAAACGTTGTTCCGCTGGAATGAAGC
CAAAGCCAATTGGAATTGTATCGTACTGGA
Sequence Type genomic DNA
Unitrap ID UNI10754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55190926..55191275 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]

 
Come back to gene ENSMUSG00000022178


For any suggestions or comments, please send an email to unitrap@crg.es