Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145A03
Clone ID P145A03
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145A03
Sequence
GAGTTNNNCCATCTAAAAAGGGAGGGGTCCAAGGAGCTGNNNTCCTAGCCGCCTAGATTTCNNNTGTGGCTCTGGGTACG
AGTGGCAGTTTCTTCTTGGGATTTCAGAAAGGAAACCAAGGAGGAAATAGAGCGCNNNGCATCGCTGTGGGCATTAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP145A03
Sequence
GATCCAGAATAGTGGTTTAACTTAACACCCTATAATGGTTTCCTTTG
Sequence Type genomic DNA
Unitrap ID UNI11663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44391330..44391376 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


SPLK-Sequence tag 3SP145A03
Sequence
ATTCCCAGCCTCCTTTGCACTTGGACCNNNGCCGCCATACTACCGACCGACTTTTCTAAGAATTACGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es