Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P144C07
Clone ID P144C07
Vector ROSAbetageo0
Project ggtc

Sequence tag P144C07
Sequence
GNNGNCTTAAAATGAAAATATGCTANNNNCCAAAAAGAAGAATGAAGNNGNNAAGAANNGNNNGTCTATTGAAAGAATCT
ATCAGAAAAAAACACAACTGGAACATATTCTTCTCCGCCCAGATACCTACATTGGCTCTGTGGAGTTAGTGACCCAGCAA
ATGTGGGTTTACGATGAAGATGTTGGCATTAACTACAGGGAAGTCACTTTTGTTCCTGGTTTGTATAAAATCTTTGATGA
GATTCTAGTTAATGCTGCTGATAACAAACAAAGGGACCCAAAAATGTCTTGTATTAGAGTCACAATTGATCCAGAAAATA
ATGTAATTAGCATCTGGAATAATGGGAAAGGAATCCCTGTTGTTGAACACAAAGTTGAGAAAATATATGTCCCAGCTCTC
ATATTTGGACAACTCCTGACCTCCAGTAACTATGACGACGATGAGAAGAAAGTGACAGGTGGTCGAAATGGCTATGGAGC
TAAACTGTGTAACATATTCAGCACCAAATTTACTGTGGAAACAGCCAGTAGAGAGTACAAGAAAATGTTCAAACAG
Sequence Type mRNA
Unitrap ID UNI10996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98877744..98884301 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]


SPLK-Sequence tag 5SP144C07
Sequence
AATTTACTGTGGAAACAGCCAGTAGAGAGTACAAGAAAATGTTCAAACAGGTAAAGTAAAGCTTGTGGTTTGCTAAACTG
TAG
Sequence Type genomic DNA
Unitrap ID UNI10996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98877711..98877793 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]


SPLK-Sequence tag 3SP144C07
Sequence
CTTTCCTGTTCTTTACTGCCATAGACGTGGATGGATAACATGGGGAGAGCTGGTGACATGGAACTCAAGCCCTTTAGTGG
AGAAGATTATACATGTATCACCTTCCAGCCTGACTTATCTAAGTTTAAAATGCAAAGCCTGGACAAAGATATTGTTGCAC
TGATGGTCAGAAGAGCATATGATATCGCTGGCTCCACNNNAGATGTCAAAGTCTTTCTTAATGGAAATAGTCTGCCAGTG
AGTATTTTTCTGGGAATATGGGCTGCAAAGG
Sequence Type genomic DNA
Unitrap ID UNI10996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98877308..98877578 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]

 
Come back to gene ENSMUSG00000020914


For any suggestions or comments, please send an email to unitrap@crg.es