Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0173
Clone ID CC0173
Vector pGT0lxfT2
Project sanger

Sequence tag CC0173
Sequence
CCAGTGTTGGCTGACTTACAGCTTCTCTAAAGTAGAGGCAGTTTCTGAACCTCAGGCTCCTGCCTCGCAGTTCTGGCTTG
TGAGCACCAATGCAAAGAACTGCCCGGAGCGAG
Sequence Type mRNA
Unitrap ID UNI1127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12312169..12312281 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]

 
Come back to gene ENSMUSG00000023827


For any suggestions or comments, please send an email to unitrap@crg.es