Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P143G10
Clone ID P143G10
Vector ROSAbetageo0
Project ggtc

Sequence tag P143G10
Sequence
CGGGAAGATTGAGTGCCTAGACGGTCGCCCAGGAGCAG
Sequence Type mRNA
Unitrap ID UNI10502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88725711..88725748 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]


SPLK-Sequence tag 5SP143G10
Sequence
AATTTGAGTCTTGCTGGGGAAGGGATTTTCAAGTTAGTAAGGA
Sequence Type genomic DNA
Unitrap ID UNI29476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88709183..88709225 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es