Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P143E11
Clone ID P143E11
Vector ROSAbetageo0
Project ggtc

Sequence tag P143E11
Sequence
TTGGTAAGAGGCACATTGGCAGGTAACGAGCGGCGGCGGCGGCGGGTCCCGAGTCCAACGAGAGCAGCAGCG
Sequence Type mRNA
Unitrap ID UNI4705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41222073..41222144 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]


SPLK-Sequence tag 5SP143E11
Sequence
AGTCAGCTCTCCCACCTTCCCCCCTGCATTTTCAGGTTTAGTTACCCAGGCATAGTCAGCTCTCCCACCTTCCCCCCTGC
ATTTTCAGGTTTAGTTACCCAGGCATGTCAACTGTCACCACTTAGGATTCGTGTTTTCTCTTTGGGTTGGTCTGGAAGTC
TTCCTG
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41221211..41221377 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]


SPLK-Sequence tag 3SP143E11
Sequence
TAATCTCGTAGTTACTACCACTAATACGCCTTTCTACTTTATTTCCAGGTGCATAGTCTGCCTACTCTTTACTTTTCTCC
AGCAATTGTGTACAGTAACAATTGGAGCTTTTAGGTGATTCTATGAGGTACCCAGAGATCATTTATTTGAAGAGCATGCC
TTTTTTTGGGAGGGCG
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41221015..41221192 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es