Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P142E10
Clone ID P142E10
Vector ROSAbetageo0
Project ggtc

Sequence tag P142E10
Sequence
GGGGGCGNNNTTCCTGTGGGTTGTTGGAGAAAAGAAGAGAAAGGAAAGCGCGAGGAGACGCCGCCGCCGCCACCGCCACC
GCCGGCAGCGCAGCTGTGCCACAGCCGCGAGGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCCGTGTCCTCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP142E10
Sequence
CGCTTGGCTCCCGGAATACGGGTGCAGGAACCGGGTCGACAGTGGGGCCGGTACTGCTCACAAGGCCGAACGGGTTCCAG
TCTAGGCTGTAGTCTTGTGTCTAGGTCTGTGGCTGAATGAGTCTGGTGTCGACACTAGTGGTAGATTGGGTCTGTGGAGA
GCGTTTGCCGTTCTTGGTCAGGCCTAGCTCGGGGCTTAGCTGCGGTCCGCTTCCCTAGTTCTCTGGTCGAAGGTGGCGGT
TGGGCCCGGCACGCGCTAGGTCGGCCGCAGAGCTCCAGGAGTAGGCAAGGCTGGTGTCACCCAGTCCTGGCGTCCTCACT
GCATTCTGCAAGCAAGGGGTCAGGTGGCCTGCGAAGAGCAGGACTCCCATGGAAGGCGCAATCACCGGCCCAGGCCTCCA
GGCAGCGAAGGGGGCCGGGTGGGAAGGCCAAGGCGGTTTCCAGGGACTGTTGGGAAGTTTGTCAGGCGACCCGCCTGGCT
CAGCTTACTTTTAAA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062731..30063225 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es