Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P142E04
Clone ID P142E04
Vector ROSAbetageo0
Project ggtc

Sequence tag P142E04
Sequence
AGAAGGCTCTANNCGCTGAGAGGTAGGAGGCACTGGGATCGTCNNAGGGTTTGGGACAGCTACAGAGGCCNTCACGGAGC
CCGCCGGAGCCCCCGTTCCTGCTGGTGCTGCCGCCGCCCGAATCGGANNNGTCGGGCTGCAACCGCCGGCAATGCCGCGA
AGGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP142E04
Sequence
AAGGTTTAGTTGTACTATTTTAATTATCTGGATGTGTGTAGGGATGTGT
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95168049..95168097 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


SPLK-Sequence tag 3SP142E04
Sequence
TTCAGTCCAGACGGTTTCAGAAATAGTGAGACGGCGCGAAGAATTATTTCTCTTCTCGCCCTGCTGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es