Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P142D08
Clone ID P142D08
Vector ROSAbetageo0
Project ggtc

Sequence tag P142D08
Sequence
TTAGACCGGTGCGGAGGTGGTGCGGAGCGTGTCGGCTTCGAGCTCCTCGCAAAAGTGTNNCGTCGCGCTAGGCTGCGGCG
GAGCCTCTGTAAGGAAGGCGGGAGCTTGACAGCTTCAGGAAAGGCCCGTAGCGGTGACAGCGACCCGGAGTCATGAGCGA
CAGCGGCGAGCAGAACTACGGCGAGCGG
Sequence Type mRNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22265814..22266001 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]


SPLK-Sequence tag 3SP142D08
Sequence
ATTGTTTCAGTTTAACGCCTGTTCCAACTGAACTAGGGTTTTTGCTGAAGTATATATAGTAGCGTCCCTNNNAAGAAATG
GGTCAGACAAATGAAATGAGAGCTAATTCAAAGTGTGATAGTAGCTGGTATTTGTGTCTTTTATCTTTAGTTTATTACAA
TGATTTNNNAGTAAATATTGTTTTCTTCTAGTGTGCTACTCCAACTGAGGAAAAAAACCACACAGTTCCTGTCTATGTTT
TGACTGATTATATATAGTTAAGTGATTAGCATAATGCTAATACCAAGCACACACAATCCACAAAAAACCAATAGCTGTCT
TTACCATGCAGAATATTAAATAAAGATTATCATCNNNAAGCTAT
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22258129..22258492 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es