Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P142A02
Clone ID P142A02
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP142A02
Sequence
AATTTACATCTGTTTTTCCTATGCCAATCAAGCATTTAAAGGGCTAAGTGGCGATTTGTGTACGCTTGTACTCTGGTCTT
TGGGTGATGGCGGACAGTACCACTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6040555..6040663 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


SPLK-Sequence tag 3SP142A02
Sequence
ACTGGAGGCTCTGAAATGGGAGGGTTGCAGACCAGGATG
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6040500..6040538 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es