Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P141F01
Clone ID P141F01
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP141F01
Sequence
TCCAAGGGCAGGTTTTAACTTCCTTTTGCTCGCTGACTATGGGCCAGCACATTTGGAAACTGCAACGGACAATGCCATGT
GTCGGCCATTGTGAAAGTTCCTAATGCTTGCCGTCCGTCTGGCAAGGGTCCTGTTAGGGACCACTGCCCACCACTGGCCC
TGTTGAGGTTTTCCTTTGAGGAAGAGCACAGGACTTAGAACAGCCTGATCATGAAGCCTCAGGCAGGTGAGACACTCTCC
ACATTCAGTTTGGATGGAGTGGTAATAG
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25694027..25694295 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


SPLK-Sequence tag 3SP141F01
Sequence
ATAGGACTCCTGGGGATTTCTTCCAGGCCATTAGAATCCCTGGCCTGTGGTAAGGTGCTTTTTCCCTTTAATTCAGGAAG
GAAATGGTAGCTTTCCTTTGAGCATCCATGCTTAATGTCACACACACACACACACCCATCCAGCAAGCCAGGACCCGGTC
CTTTGAGAGCATACAGTTGTCCTTCTGCAGTCTCAGGAGCCACACACTGGTTTGAACCCTGGTGGCTTCCTCTGGAGAGA
GGAGGGAGGGAGTCCACCCTGCGGTATGGAGAGCAGGAAGCTGTCCCTGGGCAGTGGTAAGCAGGCAGCCCTGCAGCAGG
GAAGGAAGTCTGCAGTAGATCCAGGGTCTGAGAGAAGAAGGAAGCTGGAAGAGTGTGGCTGGAGGAAGAGCTATGGCGGA
GGCTGGCTTGCCTTCCCATGCCTGGGGAAACATTTGACCATATATTCACTGGGCCTGACTAGGCCCGTATGGGGTTTGGA
AACAAGTACGTGACAGGGTACAATAGCTGCTAAGGTCTGAATGTGTGACCGTCCCAAGGGTACAGTGAGAGAGGAAAGCT
TGCTCCAAACACTGGAGGGCCGGTAGGCG
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25694314..25694900 575
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es