Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P141C11
Clone ID P141C11
Vector ROSAbetageo0
Project ggtc

Sequence tag P141C11
Sequence
CTCTCCTTTGCAGTCCTGAGCTCGCAGTTCCAGGTTTTGGTTGCTGCGTCCTTGGCTGGCGT
Sequence Type mRNA
Unitrap ID UNI7339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75739675..75739736 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]


SPLK-Sequence tag 5SP141C11
Sequence
AATTTTGGGGGCCCAGCTCTTGCTAACGCCCTAGGTCTTTGCGGTTAAGCACCAAGGGCGTACCTAACTCTAGGCATAGA
GGGAGGTTGCTTCGGGTGCTGACTGGTGGAACTCGTACGGTC
Sequence Type genomic DNA
Unitrap ID UNI29484

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75739294..75739415 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]


SPLK-Sequence tag 3SP141C11
Sequence
AAAAAGGGCGTGGTGGTGTCGATTTGCTCAAAAGTAACAGGACTAGCTCTACTTACTGATTTGAATAAGGTGATCTGGGC
AGCTTTCTTTGGAAAGGGGCGTTGAAGGGAACGAACGCCCCTTTTCTAATACATGAGCACTCTCTCCGGGCATCATGGTT
TTCTAGAGTGAACGCATAACCGGCAGCACCAAGAACTTGCTGAAGCAATAATGTTGGGATGCTACTCCCAAGGATGCTTC
TGAATTGGCCCTGTCACTCGGGGATGGATAACTGGGTCTTATCTCAGGCGGATTCTCATGGATGAAGCAAAGGATGGATG
TGACAGGACTACCGAGTGCCCCCTAAGCCAATCCCGTGGGGCAACAGAGTCAAGAGGAAGAAGTC
Sequence Type genomic DNA
Unitrap ID UNI29484

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75738892..75739276 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]

 
Come back to gene ENSMUSG00000055762


For any suggestions or comments, please send an email to unitrap@crg.es