Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P140E09
Clone ID P140E09
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP140E09
Sequence
AATTTAAAGATGGCTTTATCAGGATCTAATGGGATAGTACATACATTTAAAGGGGTGATCTGATGTTTATGTAGTTATCA
GCACAATCAAGATAGCAAACTGTTTATCCCTGCAAAAATACTCCCAGTACCCCTGTGTGTTCCCTCCTAGATAAGGAAAC
TGAGCCAGCAGGTTCCAGTTTAGCCTGGACAATTTAATGAGATCCTGCTTAGAGAAAAAGCCTGCCTAGCATTCACTGAG
TTCCAACCAAGCACTGGGGAAAAAAGAGTCCTTGGTTAACTTAACTGCCATGTATGTAGTTTCTTTGGAAGGTTGGCTT
Sequence Type genomic DNA
Unitrap ID UNI4710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55290341..55290659 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]


SPLK-Sequence tag 3SP140E09
Sequence
AAACACTGTTGCGATAAGTTAGTTCCATGGATCCCTTTGGCTATTTTCTTAGCTAAGGACAACTATCTATCTGGCTTTAC
TTTGCAGGTATTGAAAATGGCGTTGAGACATTTTCCTCAGTACTACATGGTGCTTTTTAAAACAGTTGACCTGTTTTATT
AAAATTGCTTTTTAGATNTTTTT
Sequence Type genomic DNA
Unitrap ID UNI4710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55291050..55291232 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]

 
Come back to gene ENSMUSG00000018583


For any suggestions or comments, please send an email to unitrap@crg.es