Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P140C01
Clone ID P140C01
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP140C01
Sequence
AATTCCCTTTACTTTGCCCATCCACTTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP140C01
Sequence
TAAGTGGCTTTGTACAATGTTGTATAACCACTGCTAGCTATTCCCGCATTAACTCCTTGTATTATTT
Sequence Type genomic DNA
Unitrap ID UNI10402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37299465..37299531 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es