Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P140A03
Clone ID P140A03
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP140A03
Sequence
TGGGACCCACGACATCCTTGCTTGCAGCTGTCTGTTCTATGCCTTTTGAACAGACAACTGCTTTTCAGGGTGGCCTGGAT
CAGAGGATCTCCTAGGTGACTCTGGTATAAATTGT
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121133988..121134102 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es