Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P139E09
Clone ID P139E09
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP139E09
Sequence
ATGGGAAATCACGCCCTTTTAAGGGCAAAGATGGAAGCTTTTCCTCTGCTTACCAGAACTAACGTGTGTTCTAATCAGGT
TNNNATTTATAAAGGAAATGCCACCTTTTACAACCAGCCATTTTTTTAAAGAGGCAAGGGCCACATCCAGAAACTTAGCA
GGCAAAGGCTGCAAATACCCCTCACAGAAGGGAAGCCCAAAAATCGGTGTTAGGGGGAAAGGGAGTAGACCACAGAAACA
AGGTCCCTTCTTAGCCGGCTGGCTTGCTCAGGCAGTTGAGAACGCTGACATTCCGAAATCAGCCAGTTAAGCTGTCCCGG
GAGGCCGGTTTGTTAAGGGGAATTAGCGAATGTTGCCCTTACATCATAGATAGTCTGGGATTTCACATCACATCAGACCA
TGTTTGGAGACTGTCCCCACATACCATGACAGTCACTGCAGAGAAGGGGACTTGATAGCGTTTTCTGTAGGCCTGACAAA
CCTGGCTGAGTGGGAACACCAACTGTTGCCGGGTCTAGGGGCTTTGGGGGTTAGTGAAGCCCACAGCAACTTACTTGGCA
GCCATCTGGACATGTTTGTTGTGGTGACCGTGGGGGGTTCCAGGGCAGTTGTGCTAGCCACAGAAAGCTACGTGAGCTGT
AATTGGACTCTGTACGTACAAATATGTTCCTTACTTATGNNNTTAAATGCTAAG
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110367889..110368583 665
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]


SPLK-Sequence tag 3SP139E09
Sequence
CTTTACCGCTGAGTTTGTAAAAGGCTCATTAAGAGCTGGGTGTGGGAGAAGACTGTGTCTGTCTCTCCACTCCCATATTA
TTCCTGTGGGTTCTAGGGGCTTACTTTGCATTGTACTCTGATGACCTGTCTCTTCCACTGGATGCAAAGATCCCTTTGTC
TTCTAGAAAAGAGGCTGTCTGAGTCAGTTTCCTAATGAGAGCTATAATTTGGGAGTGGAGATGGAGCTATTTTGGAGGAA
CGCGGGCCTCTGAAAGATGTGGTTTGGGTGGTTCACGAAGAAGCAGGATCTGCTAGTACGCACTGTCTCGTGGGCTGAAG
CAGCCCGGAGGGAACTCGTAAAACAAGCATCCTAATGCATCCTTTGTTCCGCAGAATGCCTGTCTGGGGCGGTGGAAATA
AGTGCGGGGCCTGCGGGAGAACCGTGTACCACGCGGAAGAGGTGCAGTGCGATGGGCGGAGCTTCCATCGCTGCTGCTTC
CTGTGCAGTGAGTATGGTCCCCTCCCCCTTCAGTTCACCTCTGGAAGAAAAATAACAATGCTAGCTAAGAGAAATGGTTT
AGAGTGA
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368637..110369203 563
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es