Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P139E06
Clone ID P139E06
Vector ROSAbetageo0
Project ggtc

Sequence tag P139E06
Sequence
GCGCTCCCCCACGCATTGGGCGTGACCGCCCCNNNNGCACGTGNNGCGGGCAGNCNNTTGGCCGACGAACAGGGGAGACA
CNNAAACGGAGCGCACCCCGATCGANNTGCGCCGACAAAAANNNNTCCGACCNNCGCCCAACAACCCTNNCAAACACGAC
GCTTAGGNNCNNCCCNNCGGGGGCCCTAATCCAGCANCGCGGCCGACGCCTTTCCCACCTCCCGAGCACGAGGANCNNGA
TGAGGAGGAANNGACTACCTCCGGATGCTCGTGGCNNANNGGNNCGCCCAACAAGATAGCTGTGTTCCAGTTTTGTTCAA
AACTACTAGTGAAGAAGNNCTCCTCTCCTCTCATTACCATATCTGCTTTCCGTCTGGACACAACATTGGGTCTAAGAAAG
TCAGCGCAGCAGGCTNNNNCCTCTGAATCACGGTGGAGTTCTCTCTC
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP139E06
Sequence
AATTCCATGGAAGGTTCATCTGGGGTGTGATATGTGTGATAGTCTGTACCCAGATTTTGGTTTGCTTTGGTCTGAAAGAT
CCCTATCAATGAAAGTTAGTTTCCCCTTAGTGTTTAGTTTTGGTTATTTTGGG
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32376038..32376170 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SP139E06
Sequence
TCATTGCCCTCTCCCTGGGACAAGAGGAAGGCAGATTAGATTAA
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32375734..32375777 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es