Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P139D12
Clone ID P139D12
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP139D12
Sequence
GGTCGCATCCTGGACCTCTACCCATAATTCCTTTCGTCTCTCGGCTCCTAGATATTTTACGCAGAGGCCCCTGGCTTCCT
GGATATTATCCTTATGACCTCCCTTGAAATCCCTACTTCATAATCTTAAAGGTATGAAGCGACCAACCTCTAGAGCGCGA
GGCTTCGACCTGGGTACCACACCTGCTACTCCTTTTCTCCTTTGTTCTCTNCNNCCAGCCTTAAGTCTTCCAGCTCTTAC
CAAGAGCTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP139D12
Sequence
TGGGTGAAGGGGGCCTAAAAGAAAGCAGTGCTAAGTAAAGTATGCTAACATAACGTTTCTGGTCTTAG
Sequence Type genomic DNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52650186..52650253 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es