Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P139C03
Clone ID P139C03
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP139C03
Sequence
GCCAAGGAGGTCACAACTTGTAGGTTGAGACTCATAGCGCAAGAGCATCTCACCCAGCCACAGCAACACTACCGCNNCCA
AATATCTCTAAACTCTCCCTTTACACCTGGTGGTTACTTAAAATAAGCCACAGCTTATATTTATAATATGTAAAATGAGA
TGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP139C03
Sequence
ATGCAGGGGTGCTGATGGAACCAGACTGACAATGGTGATCTGTCCTGTGCTATTGAAAAGGATATGTGGATAGGTGAAAA
GAGGAGGAAAAAAAGAGGTATATAAAAATTAGAGTAGTCAGGGTTTAGATGATTAATCTGACTAAGGAAAAGGGGACATG
AAGAAACGTATTTATATTCACTATATGGACCAAGAGCGTATTAAAAGGAAGGAGTTGGAGAACGGTCAGGAATGGTGATA
GAAGACTTTGCAGTAATAGTAAGAGTAGTAGGTGGGCAGATGAAGGTTGTGCGGCTCTAGAAGCTAGAAGGGAGAGGATG
TGTAGTTATTAGAGGAGTGGTTTAGGAGGTGATTACCACCTACTGCATGAAGAAAAGTAGGAAATGATTAAGGAAACTGC
CAGANNNAATGGGTGGTCAGTAATTATAGTATNNNTTTTTTTGACTGATAGGACATTTCATCATCATCCTGCTATC
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32941676..32942151 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es