Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P139A04
Clone ID P139A04
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP139A04
Sequence
AACTGTGACTGTCAGTGCTGGCCATTCTGGTGTTCTGCGGCCCTGCTGTGTATACTTGGTGCTTGGGCACCAGTCCTCCG
CTAGTATTCCCCACACTGCGCTGCTGCTGTGTTCTGAGGAACCCATAGGTGTGAGTGCCTCCGCACAGCAGAAGTTGTCA
CCTCGTTAGGAAAGGAGAGAGGTATCTGCTGTGAGCCATCTGTAGTGGACGGTGCTCATAGAAATCCTTTGCCCAGAGGT
GAGATAGTAAGTGTNNTACCGGGACCTGCTCATGACAGTAGNNGGCTATGCTATACCTCTCTATGGGTGTGAAGGGCTCT
GGACCACGTGGTTCAGGCTGAGCTTCTGACAAGATGCTCAGAAACCGCTAGTATGATAGTAGATATGCAAGCCCAGAGCT
TGGTTAGATTCCCTACCCATAAATATAGCAGTGGAAACTGTCTATTGGACTGGCTTGTGTGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP139A04
Sequence
CGAAGAACCAACCAACCAAAGAAACCAAACTTATTATTTATTTGTCTGCTCATCTCAGATGATAAGTTGACCTGTCATCT
GTCATCTTAATAG
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52178296..52178388 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es