Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138G11
Clone ID P138G11
Vector ROSAbetageo0
Project ggtc

Sequence tag P138G11
Sequence
TAAAGNNACCGGGCGCCTTTCTCTTNNNTCGCGGCTGCAGCTTGCTTCTGTTNNCGCGCCCGCTTGCACATCCCTCCNNT
CGCGCGGTCCTGCTGACGTCCGGTGCTCCCCGTAGCCGCTCAGGCAGAGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP138G11
Sequence
CCACACTGCAACGCTAGTACCACATATCACAACAAAAAGCCAGCTGCCGGTTTAGAAAGTGTTCTCCAGCTGTGTGCAGT
CTCCTACCAGGTCCCCTCTGTAGGCCAGTATGTGCCTGAGTCCCGAGGACCCACTCGTTCAGGGCTCCCTGCTTGCCAAG
TGCATGCTAACCAGTGCAAAATGCCCTCCAGCCCTAAAATACTGCCTCCCCTCCTCCCTCCACCAACCAGCAGCCTCAGG
AGTTGAGATGAAGGCTTCACATTTGAAACATCTAATCTTATTTAGTGCAAA
Sequence Type genomic DNA
Unitrap ID UNI10643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77797794..77798084 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es