Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138F12
Clone ID P138F12
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP138F12
Sequence
ACTCTAGGATGAAAGGCCTGTAACATCATGCCCTGCTTTTTCTCATTTTTATGCCCTCTGAATCTTAGGTTACACTGCCA
TGAGCACCAGGGGACTATATCTTTCAGTTGTTTGTATTCTAACAGTAACCTAGCAAATATCTCATAGGAGATTAAACTAG
TCTTGGTTGTGTCAGTAACTTGGTCTCAGTGTAGAAATATGTAAAGTAACAG
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154277251..154277462 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es