Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138F03
Clone ID P138F03
Vector ROSAbetageo0
Project ggtc

Sequence tag P138F03
Sequence
CGAGAGTCAAAAGGCGCGCCTCGCTTTNACGCAAGATGGCTGCTGCGGGGGCATTCGCGTACTAATTTCTAGCGCGGGGA
TGGAGACGTGTANNCTGAGTTCGAAACGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP138F03
Sequence
GAAAAAAAATAGGTATAGTTTAAAGAAATGTAAAATCCTTGAACAAGATGTACATGCCACTTCTAATAGGCTTAGCCCTC
ACATGCACACCTGTGCCACTTTCCTATGAGTTGGCACTTGCACATCATGTGGAATGGCTCCTTGAATGAGCAGTCACTGT
GGCTGTCAGGCTCAGTGTGTGGCACATACACG
Sequence Type genomic DNA
Unitrap ID UNI22601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180430401..180430592 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SP138F03
Sequence
AAAGCATCTGAGGTTTCTTGCTTAACATAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es