Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138D09
Clone ID P138D09
Vector ROSAbetageo0
Project ggtc

Sequence tag P138D09
Sequence
TCTCTAGCTTTTGAATATTTCTTGCCCTTGATCGGATGCCATTCTTTCTCAGCGTAGCACTTGGAGCGAGGCATATTTGA
TATGCTGGNNNTCTTCCNNTTAAATGATTNNNNCACTAATAACATTTCCNNTGCTCGGCTACTGAGGCGGAGAGGGCAGG
ACCCCTGGGACGGCGGAGGCTCGAGCGTGCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP138D09
Sequence
GGGTCTCCTCCGACTCCCTCCCCGGAGTTTCCAGCCTGAGGTTAGATATCGAGAATCGTAGACCTCCTTCGCTCCATCTG
GAGAGTAAGACGTATAGGGTCTAGGGGTGCTTTGGGCGAATCCCCCCCGTTATAGGTTCAATGTCAGAGATCCNNCNTGC
AGTAGTCTACCAAGTCCTGGGATTAANNGCATGTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP138D09
Sequence
TATTCATTATTCATTCCACCTCAGTGCCCCTAGCCCAGGCTACCCCAATTCTGCTCCCTACTTCTGTGTCTCTCTTAAGT
CCTCAGAAAATATTTTGGACTAACTTCCTGTCCTTGGAGGTTCTGAGGCTCCAGGCAGATGCAGAGCCAATTTTATCTAC
AACTGGTAACTGCATTTCAGGTGTTCATGCCAGCAAAGTGAGGGCAGAGACGTGAGGAGACACAAACTGGAGGGACAGAG
CTATGGAGGGGAACTAAGCCAGAGGG
Sequence Type genomic DNA
Unitrap ID UNI10883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21601529..21601794 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es