Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138B04
Clone ID P138B04
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP138B04
Sequence
AATTTTTACTGCAGTACTTACAATAGTAGTATTTTACAATAATACTAATTGAATATGAATGAGCCTTGAATAATTCAGGT
TAAATG
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65195843..65195929 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


SPLK-Sequence tag 3SP138B04
Sequence
AAATAAACACTCTACACAGAGTCATNNGAGAATTTATCTTTACACGGAGTCATCGAGATTTTGGTTCTAAGAACTTATAT
TTTTTTTCCTCTAATATTGTTGGAGATACTTTATTCTCAAGAGTGGTGTTGGGGGGGAAGTATGAATTGGTATTCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es