Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138A08
Clone ID P138A08
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP138A08
Sequence
ATGTCAGTCTGCCGATCCCTCTTCCCACAAAGCTTATTTNNNGNGGATAATGCAGATGGTGTCTGAGTGTGACACTGTCC
NTCCAAGAGGTGTCTCAGTTAACTCTGTCCTCAGAGCAGGAGATGAGGAGTTAGCTCAGGGATGCCTCAGAACCTCAGCC
TGTAAAATACCAAGCTTGCAGAGAGAGGATAAGACTGTTGGCTGGTCACTGTGATGTAGACAGACAGTGGATACCGTGAC
TGCAGCTCCTCCCATCGTCGTGTCTCAGCCAGCTTGTCAGAGAGGAGCGTGTGTGGAGACAGACCCTCAGCGCATCAGAA
GCCCTGAGAGCTAAGTTACTTCCTGATGTCAGCTAATGTCTCTGGCTCCTCCATGTCCCTATGGGCCTTAGGAAGGCCGT
GTTCGGGAAGTCAGCTGCACATAACGGCTCTGCTGCTGCCCATAATGCTGACGTAAATGTGCAGCCTGAGGAGCATCGCC
AACCCAGAGGCACTGTGGCTCTGAGGCCTGGATGCTGGCTGGGAGCCTGTCCGTGTCTCATCTGCGGCTGGACCAGTCAC
TGCAGGAACCTCTAAATTGTTTTCAACTTTAATTTTATTTGTTTTCAAATTAAGTCATAAATATTTGTGGGGGGAAAAAT
CTGTTTAAGTCTGTGTAGTGAAAAAGTCCCCACTTGTTCTGCCCCTCAGTTCTGTTCCCTGGGGACAACCAATATGGCC
Sequence Type genomic DNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126705861..126706579 701
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]


SPLK-Sequence tag 3SP138A08
Sequence
TAATTTCCAGGTGTTACTCTAAAGGAATATCAAGTAGAATGGCCCAGTGGCCCTTCAGTGTCTTTAATCTTCCTTTGAGT
TCTCTACTGCCAAGAACATAAAAAAATTAAGTCACTGTGGAAGTAAAAAATATTCTTTAGACCTTAATTGCTAGTTTAAC
TTAGACATTAAAGTACTATGATGTCCATAATGGGAAGGCTGGGGCAGGAAAGAAGTAGGTTTGGTTTGTTTGTTTTCANN
NGATCCCAATTTTTCTTCTATTTCTTTAAAACAATTTTAGCTGGAAGTAAAGTATTTTACAACAGGAATGGGCTGGAAAA
TAACAGAGGCTGGCAGCCCTTCCCTTCACTGTATGGGAAGATCTGCATCTCAGCCACGCCCTGGCTGTCTGAGACAATGG
CTTCTCAGAGTGGCCTCTTTGGAAAGCCACCTCCCAAACTGAATGCCCTCTCGGGGCCCACAGCCTGCCTTGGGTCCTGA
AAGCACTCTGCTCATGGCTTAACCAGAGAAAATTAAGGACGCCTCAGAAGAACAGGACTCAGCTTCTCCCACCCTGTATG
ATATAGCCAC
Sequence Type genomic DNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126706741..126707310 560
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

 
Come back to gene ENSMUSG00000025410


For any suggestions or comments, please send an email to unitrap@crg.es