Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P137B03
Clone ID P137B03
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP137B03
Sequence
GGCCTCGCCCTGCCCTGCCGCAGTCCCCAGAACGCACCCCCCCCCAAGAATGTCAGGGCTTCACTGCCGGGCCCGAGGCA
GGGGATCCCCAACCACTAGTCCCCTACAAGATCACTCCAGATATCTTACCCGTAGATGCCCCCTAATACCGTGGGATGGC
TAACAGCTCGATTTCATTAGTAAAGAACCTCTCAAGTGCCAGGGCCCCCCACGAATCCTTTCCCTGCCGCCTCATCAGCT
TCCTC
Sequence Type genomic DNA
Unitrap ID UNI29495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4972308..4972553 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074405 (6430526N21Rik) NM_001033383 RIKEN cDNA 6430526N21 gene Gene [Source:MGI Symbol;Acc:MGI:2442656]


SPLK-Sequence tag 3SP137B03
Sequence
CTCTGCTTGCACCGGCTTGGCTGTGCTTACAGGGTAGCTGCTCCTGAACCCTCTGTTCCTATCTACTGTAGGATTGCTTC
CAGGGGGTGTAGCATTAGTACTTTGTGACTAGGGTTGCCCCCTACTATGTCTGACCACACACAACCCACTCCCCATGCCC
TCTTTGTGGGTGCAAAAAATATTTTCTATTCTGGCCCATGCTAAAAGTGCGTTTTAAGGACCTTTTCCTGCAACTGACCC
AAAAAGACCTCTTCA
Sequence Type genomic DNA
Unitrap ID UNI29495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4972563..4972818 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074405 (6430526N21Rik) NM_001033383 RIKEN cDNA 6430526N21 gene Gene [Source:MGI Symbol;Acc:MGI:2442656]

 
Come back to gene ENSMUSG00000074405


For any suggestions or comments, please send an email to unitrap@crg.es