Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P137A03
Clone ID P137A03
Vector ROSAbetageo0
Project ggtc

Sequence tag P137A03
Sequence
AGCACCGCCCCACNNTCGATTAAGACTACCCCCACCTCAGCCCTCTAATGGCACCAGCCTTCGTAGCCGCTGGGGAAGCC
CATGACCACTTCACATTCCCATGGCTCTCTANNANNNGAGTTATGNNGCCAGCAAAGTGGCNTCTCNCACTGTGCTGAAT
GGCATTTCTTAAAAACCTAGGTCCTATTAGTCCTNNACAAGCCCCCTTCAATCAGTGCGTGGAATAAGCCCTTAACATCT
TNTGGATCAGCAACTTCATCAGAGGGAACAAGAAATGGTCAAGAGAGTGGTGTTGAAATTGGAATTGACACACTTCAGTT
TGATNNTCCGGCCTCAATCGGGAATGAAAATGAGGTGGTTCCTGTGCTTTCAGAGAAAGCAACTGATAAAGTTCCTGNNN
CTAAAGAGCAGCGGCAGAAGCAGCCTCCGGCAGGGCCCATTAAAGCTCAGAAGCTTCCAGACTTGAGTCTGGTAGAAAGC
AAAGAACATAACCCTGGTCCCATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTGAAAGATGCCCAGCAGGTCGAGCC
AGAAGGACAAGAGAAACCCAGCCCAGCTGTGGTCAGAAGCACTGATCCTGAAACAGCAAAAGAATCCAAAGCAGTCTCCG
AAATGTCTGCTGAAATTGGGGCGATGATCTCAGTCTCCTCTGCAGAGTATGCCTCTCATGCAAAG
Sequence Type mRNA
Unitrap ID UNI10172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 164622504..164627734 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040225 (Bat2d) NM_001081290 BAT2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913754]


SPLK-Sequence tag 5SP137A03
Sequence
AATTTTTCTGGACATGAAGAGAGAATTAAACCTTTAGTTAGAATATTTCTAAAAATACTTTTGCAAAGAGTATTTATATT
TAAGACTTTCCTGATAGATACTCTTAGGGTCCCCAACATTATCTGTGTTTTTAGAAATGTTCACTGCTGTCATCAAAAGA
GCAGACATTGACTA
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856669..97856842 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 3SP137A03
Sequence
CCCTTAACCATCCACCTACAAACTCAGAGGTGCACCTTACCCAACTGTAAGCAAATCTTTTACAGGGACTAGAAAGGGCT
TGCTGAGCACTGCCGAGGACCACGTAGTTTTGGGTTGTAGTAGCTTTTCAGTTATTTCATTATTGGCACACTCAACTTCT
TGGCTCTCAGAGGAAGGAGAGTGGTTG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857188..97857374 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es