Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136F12
Clone ID P136F12
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP136F12
Sequence
AAAGAAATGTTTATTTACTTTGTGTATCTATGCAACTTTTGTGAGATTGTTCTCTCTCTCCATCATGT
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62260547..62260614 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SP136F12
Sequence
CTGGCTTAGCAAGTANNNGGTGAGCCATCTAGCTGGCCCTATCTTATCTATCCTTCTAAGTAAGACGTTAAGCTATCATA
AAAGGTAAGTCATGTGTGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es