Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136F10
Clone ID P136F10
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP136F10
Sequence
TTGTGTGTGGTGTGTGTGCTTATAGGGTCTTTTGGGTTGTTGGATTCTGTCTACACAAACTCAGTTCTAAGTCACTCATA
GATAGATCCTCAGCCCTCAGAAAATGTCTGGCGCACCCATTTGGTGGACATAGTCAATTCTCTGTATTTGGTTACATTTA
CTTATGA
Sequence Type genomic DNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12655102..12655268 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]


SPLK-Sequence tag 3SP136F10
Sequence
AAGGAACTTCACATTAATCAGTCATTAAAATATTTGCTATTTTGATATTTCCCTTCACTAGTTAGAGGAGTCCTGACTTA
TGTGAGTGAGCGGGCGGGCGAGAGAGAGAGAGAATCAATCA
Sequence Type genomic DNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12655586..12655706 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es