Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136F02
Clone ID P136F02
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP136F02
Sequence
AGGAGCCGTGGTACCTGACCCATGCCTGCTGTGTTCGGGAGGGTCCTGAACGTTGCAGTATTTGGACAGGATCAGACTCT
CCATGTCAAGGTAGCCCAGGCTGGCCTAGAAGTTAAGAACCTCTAGGACTGTCATTACAGGTAGTCGGCTTACATCCTAA
TTTTA
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168585356..168585520 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es