Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB629
Clone ID XB629
Vector pGT0pfs
Project baygenomics

Sequence tag XB629
Sequence
TGTGTGGGTATTTCTAAGGCCCGAGGGCGGCTCCTGGAAAGGAACGGGGAAGACTACATCTGCCCAAATTGCACCATTTT
GCAAGTGCAGGATGAGACAAACGGTAGCGCCACCGATGAGCAGGACTCTGGGTGCAGATCTGTGGGTGCTGATGGCACAG
ACTGCACAAGCATAGGGACAGTAGAGCAGAAGTCCGGAGAAGACCAGGGCATAAAGGGTAGGATTGAGAAGGCAGCAAAC
CCCAGCGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCGTAGAGGCTCCTGGTGCTCCTAAATGCATTGGCCCTGGGTG
TTCCAGTGTAGCACAGCCTGACTCTGTGTATTGCAGTAATGACTGCATTCTCAAACACGCAGCAGCTACCATGAGATTTC
TAAGTTCAGGTAAAGAACAAAAAACAAAACCCAAGGAAAAGGTCAAGACGAAGCCAGAAAAGTTCAGTCTTCCAAAATGC
AGTGTT
Sequence Type mRNA
Unitrap ID UNI10154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180419672..180422456 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es