Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136D12
Clone ID P136D12
Vector ROSAbetageo0
Project ggtc

Sequence tag P136D12
Sequence
CGAAGCCCGCAACAACNNCANNCGTAACTCCCTCCTGGAANNACATTCTCCCCCCCCTTACCCGTTCACNNCTTTGGAAA
AACNNCATCGCTAANNNNTNNGCAACCAGANNCACATACCAGGAACAACNNCATTCCCCCCCTTTCCCCACTTCCCTGNN
CATCACCGATAAGTCGGACTTCCAGAGGAAGCAGCTTTTCAAAGGCCCTGGGCAATTTCCCTTCCTGGCTGGAAGAGGCA
GAGTGTAGAGATCAGTACAGTGTGATTTTTGAGAGCGGAGACCGGGCGGCCATCTTCTGGAATGTCNTCAACGGACCCAG
TCTCATNNGAAGAAAGAGCGAGATGGACAGANNNGTACGTGCGCTGGTNNCCTAAGGGTGGCTACCTGTCCCCTTTCCAT
CAGCGTGGTCTCGCCTCTGGGGAGGGGACAAGTTCAAGCAGATTCAGAGGTTCACCCCCCAAGTCGTGCAGCTCATCGAC
TTCTCTCCGTGTGAAAGATGCTTGGTAACGTTCAGCTCTCTGATGGACACTCAGGATGACCCTCAGGCCATCATCATCTG
GGACATTCTCACGGGCCATAAGAAGAGAGGTTTTCTCTGCGAAAGGCTCAGCCCGCTGGCCCATCTTCAAGTGGACCCAT
GATGGCAAATTCTTTGCAAGAATGACCCTGGATACTCTTAGCATCTATGAAACACCT
Sequence Type mRNA
Unitrap ID UNI10968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140151854..140906282 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]


SPLK-Sequence tag 5SP136D12
Sequence
GTGGCCTAGCTCCATGCTTGCTTTAGTGCTCCAGAAGGCTAATCAAACTGTTGGCTGCATGCATGGTGGCTGTATGGTGT
GGAGGTACCATGTGAGAGCAGTCAGTGCTCCTCTTAGCCTGTGCTGTAGAAGGGAAGTGGGGCTTTATAGACTGGTGATA
AAGGCCATCCCTGCTGTGCTGGGTGGAGGTCAGGACTTCCTCCCTGCGCAGGCGCTGGCTGAAGTCACATTGG
Sequence Type genomic DNA
Unitrap ID UNI10968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140906371..140906603 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]


SPLK-Sequence tag 3SP136D12
Sequence
TGCCGTCTGATACGCAGAGTCTTGCACTGTTATGAGGGGAAGGGGAGCTGGCAAGATGACTCGGTGGGTGATGGCTCTTG
ACAACCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000056076


For any suggestions or comments, please send an email to unitrap@crg.es