Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136C07
Clone ID P136C07
Vector ROSAbetageo0
Project ggtc

Sequence tag P136C07
Sequence
AGGAANNGACTGCCTCTGGATCTTCGATCCTCACCGTGCCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP136C07
Sequence
AATTTAGACTTTGTCTCCAGAGTTAATCTTTTTTGAGCCAGTTTTGTGATCTTTGTACCAAATTACACTTTCACTTTTGG
AGAGATACAGAAGGCGGCAGTATTTTCAAGTTACACAATTCAGGCTGTTGAATGACTTGAGAGTTAGAGATTCTATAGAG
TGGAGAGTATGTTTATTAATATTTGTGCACACATGCAT
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32418920..32419117 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SP136C07
Sequence
TCACAACAACCTGCTTGGGGTTGTTTTTAAAGAAAAGCCATTCTGGGCAGTCTATGTGGCTGTAAAGTGTTTGAATGTTT
AGAGTTTGGGAAGATGGTACAGT
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32418591..32418693 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es